CRAN Package Check Results for Package seqinr

Last updated on 2014-10-23 11:49:41.

Flavor Version Tinstall Tcheck Ttotal Status Flags
r-devel-linux-x86_64-debian-clang 3.0-7 8.28 31.04 39.32 ERROR
r-devel-linux-x86_64-debian-gcc 3.0-7 8.98 30.23 39.21 ERROR
r-devel-linux-x86_64-fedora-clang 3.0-7 76.69 ERROR
r-devel-linux-x86_64-fedora-gcc 3.0-7 71.13 ERROR
r-devel-osx-x86_64-clang 3.0-7 67.04 ERROR
r-devel-windows-ix86+x86_64 3.0-7 44.00 45.00 89.00 ERROR
r-patched-linux-x86_64 3.0-7 9.29 66.03 75.32 NOTE
r-patched-solaris-sparc 3.0-7 532.40 ERROR
r-patched-solaris-x86 3.0-7 176.40 NOTE
r-release-linux-ix86 3.0-7 12.82 78.44 91.26 NOTE
r-release-linux-x86_64 3.0-7 9.12 64.45 73.57 NOTE
r-release-osx-x86_64-mavericks 3.0-7 NOTE
r-release-windows-ix86+x86_64 3.0-7 38.00 130.00 168.00 NOTE
r-oldrel-windows-ix86+x86_64 3.0-7 43.00 153.00 196.00 NOTE

Check Details

Version: 3.0-7
Check: installed package size
Result: NOTE
     installed size is 9.7Mb
     sub-directories of 1Mb or more:
     data 1.8Mb
     sequences 6.1Mb
Flavors: r-devel-linux-x86_64-debian-clang, r-devel-linux-x86_64-debian-gcc, r-devel-linux-x86_64-fedora-clang, r-devel-linux-x86_64-fedora-gcc, r-devel-osx-x86_64-clang, r-devel-windows-ix86+x86_64, r-patched-linux-x86_64, r-patched-solaris-sparc, r-patched-solaris-x86, r-release-linux-ix86, r-release-linux-x86_64, r-release-osx-x86_64-mavericks, r-release-windows-ix86+x86_64, r-oldrel-windows-ix86+x86_64

Version: 3.0-7
Check: R code for possible problems
Result: NOTE
    AAstat: no visible binding for global variable ‘SEQINR.UTIL’
    computePI: no visible binding for global variable ‘SEQINR.UTIL’
    recstat: no visible global function definition for ‘dudi.coa’
    summary.SeqFastaAA: no visible binding for global variable
     ‘SEQINR.UTIL’
    tablecode: no visible binding for global variable ‘SEQINR.UTIL’
    translate: no visible binding for global variable ‘SEQINR.UTIL’
    uco: no visible binding for global variable ‘SEQINR.UTIL’
    ucoweight: no visible binding for global variable ‘SEQINR.UTIL’
    
    Found the following assignments to the global environment:
    File ‘seqinr/R/choosebank.R’:
     assign("banknameSocket", res, .GlobalEnv)
    File ‘seqinr/R/extract.breakpoints.R’:
     assign("x.breaks", x.breaks, envir = globalenv())
     assign("y.breaks", y.breaks, envir = globalenv())
    File ‘seqinr/R/modifylist.R’:
     assign(modlistname, result, envir = .GlobalEnv)
    File ‘seqinr/R/query.r’:
     assign(listname, result, envir = .GlobalEnv)
    
    Found the following calls to data() loading into the global environment:
    File ‘seqinr/R/plotabif.R’:
     data(list = allele.names)
    File ‘seqinr/R/plotladder.R’:
     data(list = allele.names)
    See section ‘Good practice’ in ‘?data’.
Flavors: r-devel-linux-x86_64-debian-clang, r-devel-linux-x86_64-debian-gcc, r-devel-linux-x86_64-fedora-clang, r-devel-osx-x86_64-clang, r-patched-linux-x86_64

Version: 3.0-7
Check: Rd line widths
Result: NOTE
    Rd file 'AAstat.Rd':
     \examples lines wider than 100 characters:
     seqAA <- read.fasta(file = system.file("sequences/seqAA.fasta", package = "seqinr"), seqtype = "AA")
    
    Rd file 'GC.Rd':
     \examples lines wider than 100 characters:
     legend("topleft", inset = 0.01, legend = c("forceToLower = TRUE", "forceToLower = FALSE"), col = c("black", "red"), lty = c(1,3))
    
    Rd file 'acnucopen.Rd':
     \usage lines wider than 90 characters:
     clientid(id = paste("seqinr_", packageDescription("seqinr")$Version, sep = ""), socket, verbose = FALSE)
    
    Rd file 'as.matrix.alignment.Rd':
     \examples lines wider than 100 characters:
     phylip <- read.alignment(file = system.file("sequences/test.phylip", package = "seqinr"), format = "phylip")
    
    Rd file 'col2alpha.Rd':
     \examples lines wider than 100 characters:
     mtext("Effect of alpha on some colors\nNote: need alpha transparency channel", side = 3, outer = TRUE)
    
    Rd file 'computePI.Rd':
     \examples lines wider than 100 characters:
     myProts <- read.fasta(file = system.file("sequences/seqAA.fasta", package = "seqinr"), seqtype = "AA")
    
    Rd file 'count.Rd':
     \usage lines wider than 90 characters:
     count(seq, wordsize, start = 0, by = 1, freq = FALSE, alphabet = s2c("acgt"), frame = start)
     \examples lines wider than 100 characters:
     alldiaa <- "aaxxzxbxvxyxwxtxsxpxfxmxkxlxixhxgxexqxcxdxnxrxazzbzvzyzwztzszpzfzmzkzlzizhzgzezqzczdznzrzabbvbybwbtbsbpbfbmbkblbibhbgbebqbc ... [TRUNCATED]
    
    Rd file 'crelistfromclientdata.Rd':
     \usage lines wider than 90 characters:
     crelistfromclientdata(listname, file, type, socket = autosocket(), invisible = TRUE, verbose = FALSE, virtual = FALSE)
     clfcd(listname, file, type, socket = autosocket(), invisible = TRUE, verbose = FALSE, virtual = FALSE)
    
    Rd file 'dinucl.Rd':
     \examples lines wider than 100 characters:
     legend("bottomright", inset = 0.02, legend = paste(substr(x,1,1), "p", substr(x,2,2), " bias", sep = ""), cex = 1.25, bg = "white")
    
    Rd file 'dotPlot.Rd':
     \examples lines wider than 100 characters:
     dotPlot(dna[1:200], dna[1:200], main = "Dot plot of a nucleic acid sequence\nwsize = 1, wstep = 1, nmatch = 1")
    
    Rd file 'draw.rearranged.oriloc.Rd':
     \usage lines wider than 90 characters:
     draw.rearranged.oriloc(rearr.ori, breaks.gcfw = NA, breaks.gcrev = NA, breaks.atfw = NA, breaks.atrev = NA)
     \examples lines wider than 100 characters:
     breaks <- extract.breakpoints(r.ori, type = c("gcfw", "gcrev"), nbreaks = c(2, 2), gridsize = 50, it.max = 100)
     ### Draw the rearranged nucleotide skews and place the position of the breakpoints on the graphics ###
    
    Rd file 'extract.breakpoints.Rd':
     \usage lines wider than 90 characters:
     extract.breakpoints(rearr.ori,type = c("atfw", "atrev", "gcfw", "gcrev"), nbreaks, gridsize = 100, it.max = 500)
     \examples lines wider than 100 characters:
     ## Not run: breaks <- extract.breakpoints(r.ori,type = c("gcfw", "gcrev"), nbreaks = c(2, 2), gridsize = 50, it.max = 100)
     ### Draw the rearranged nucleotide skews and place the position of the breakpoints on the graphics ###
     ## Not run: draw.rearranged.oriloc(r.ori, breaks.gcfw = breaks$gcfw$breaks, breaks.gcrev = breaks$gcrev$breaks)
    
    Rd file 'extractseqs.Rd':
     \usage lines wider than 90 characters:
     extractseqs(listname,socket = autosocket(), format="fasta",operation="simple",feature="xx", bounds="xx", minbounds="xx", verbose = FALS ... [TRUNCATED]
     exseq(listname,socket = autosocket(), format="fasta",operation="simple", feature="xx", bounds="xx", minbounds="xx", verbose = FALSE, n ... [TRUNCATED]
    
    Rd file 'gb2fasta.Rd':
     \usage lines wider than 90 characters:
     "ftp://ftp.ncbi.nih.gov/genomes/Bacteria/Agrobacterium_tumefaciens_C58_Cereon/NC_003065.gbk",
    
    Rd file 'get.db.growth.Rd':
     \usage lines wider than 90 characters:
     get.db.growth(where = "http://www.ebi.ac.uk/embl/Documentation/Release_notes/current/relnotes.txt" )
    
    Rd file 'getTrans.Rd':
     \usage lines wider than 90 characters:
     getTrans(object, sens = "F", NAstring = "X", ambiguous = FALSE, ..., frame = "auto", numcode = "auto")
     getTrans(object, sens = "F", NAstring = "X", ambiguous = FALSE, ..., frame = 0, numcode = 1)
     getTrans(object, sens = "F", NAstring = "X", ambiguous = FALSE, ..., frame = 0, numcode = 1)
    
    Rd file 'ghelp.Rd':
     \usage lines wider than 90 characters:
     ghelp(item = c("GENERAL", "SELECT", "SPECIES", "KEYWORD"), file = c("HELP", "HELP_WIN"), socket = autosocket(), catresult = TRUE)
    
    Rd file 'kaks.Rd':
     \examples lines wider than 100 characters:
     s <- read.alignment(file = system.file("sequences/test.phylip", package = "seqinr"), format = "phylip")
     Anouk <- read.alignment(file = system.file("sequences/Anouk.fasta", package = "seqinr"), format = "fasta")
     Darren <- read.alignment(file = system.file("sequences/DarrenObbard.fasta", package = "seqinr"), format = "fasta")
    
    Rd file 'm16j.Rd':
     \examples lines wider than 100 characters:
     title(xlab = "position (Kbp)", ylab = "(C-G)/(C+G) [percent]", main = expression(paste("GC skew in ", italic(Escherichia~coli))))
    
    Rd file 'modifylist.Rd':
     \usage lines wider than 90 characters:
     modifylist(listname, modlistname = listname, operation, type = c("length", "date", "scan"), socket = autosocket(), virtual = FALSE, ver ... [TRUNCATED]
    
    Rd file 'permutation.Rd':
     \usage lines wider than 90 characters:
     permutation(sequence,modele='base',frame=0,replace=FALSE,prot=FALSE,numcode=1,ucoweight = NULL)
    
    Rd file 'query.Rd':
     \usage lines wider than 90 characters:
     query(listname, query, socket = autosocket(), invisible = TRUE, verbose = FALSE, virtual = FALSE)
    
    Rd file 'read.abif.Rd':
     \usage lines wider than 90 characters:
     read.abif(filename, max.bytes.in.file = file.info(filename)$size, pied.de.pilote = 1.2, verbose = FALSE)
    
    Rd file 'read.alignment.Rd':
     \examples lines wider than 100 characters:
     mase.res <- read.alignment(file = system.file("sequences/test.mase", package = "seqinr"), format = "mase")
     clustal.res <- read.alignment(file = system.file("sequences/test.aln", package = "seqinr"), format="clustal")
     phylip.res <- read.alignment(file = system.file("sequences/test.phylip", package = "seqinr"), format = "phylip")
     msf.res <- read.alignment(file = system.file("sequences/test.msf", package = "seqinr"), format = "msf")
     fasta.res <- read.alignment(file = system.file("sequences/Anouk.fasta", package = "seqinr"), format = "fasta")
    
    Rd file 'rearranged.oriloc.Rd':
     \examples lines wider than 100 characters:
     ## Not run: breaks <- extract.breakpoints(r.ori, type = c("gcfw", "gcrev"), nbreaks =c(2, 2), gridsize = 50, it.max = 100)
     ### Draw the rearranged nucleotide skews and place the position of the breakpoints on the graphics ###
     ## Not run: draw.rearranged.oriloc(r.ori, breaks.gcfw = breaks$gcfw$breaks, breaks.gcrev = breaks$gcrev$breaks)
    
    Rd file 'savelist.Rd':
     \usage lines wider than 90 characters:
     filename = paste(gln(lrank), ifelse(type == "N", "mne", "acc"), sep = "."),
    
    Rd file 'stutterabif.Rd':
     \usage lines wider than 90 characters:
     stutterabif(abifdata, chanel, poswild, datapointbefore = 70, datapointafter = 20, datapointsigma = 3.5, chanel.names = c(1:4, 105), DAT ... [TRUNCATED]
    
    Rd file 'trimSpace.Rd':
     \examples lines wider than 100 characters:
     stopifnot(all( trimSpace(testspace, trailing = FALSE) == c("with leading space", "with trailing space ", "with both ")))
     stopifnot(all( trimSpace(testspace, leading = FALSE) == c(" with leading space", "with trailing space", " with both")))
    
    Rd file 'words.Rd':
     \examples lines wider than 100 characters:
     c("aaa", "aac", "aag", "aat", "aca", "acc", "acg", "act", "aga", "agc", "agg", "agt", "ata", "atc", "atg", "att",
     "caa", "cac", "cag", "cat", "cca", "ccc", "ccg", "cct", "cga", "cgc", "cgg", "cgt", "cta", "ctc", "ctg", "ctt",
     "gaa", "gac", "gag", "gat", "gca", "gcc", "gcg", "gct", "gga", "ggc", "ggg", "ggt", "gta", "gtc", "gtg", "gtt",
     "taa", "tac", "tag", "tat", "tca", "tcc", "tcg", "tct", "tga", "tgc", "tgg", "tgt", "tta", "ttc", "ttg", "ttt")))
    
    These lines will be truncated in the PDF manual.
Flavors: r-devel-linux-x86_64-debian-clang, r-devel-linux-x86_64-debian-gcc, r-devel-linux-x86_64-fedora-clang, r-devel-linux-x86_64-fedora-gcc, r-patched-linux-x86_64, r-release-linux-x86_64

Version: 3.0-7
Check: examples
Result: ERROR
    Running examples in ‘seqinr-Ex.R’ failed
    The error most likely occurred in:
    
    > ### Name: consensus
    > ### Title: Consensus and profiles for sequence alignments
    > ### Aliases: consensus con
    >
    > ### ** Examples
    >
    > #
    > # Read 5 aligned DNA sequences at 42 sites:
    > #
    > phylip <- read.alignment(file = system.file("sequences/test.phylip",
    + package = "seqinr"), format = "phylip")
    > #
    > # Show data in a matrix form:
    > #
    > (matali <- as.matrix(phylip))
     1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17
    Turkey "a" "a" "g" "c" "t" "n" "g" "g" "g" "c" "a" "t" "t" "t" "c" "a" "g"
    Salmo gair "a" "a" "g" "c" "c" "t" "t" "g" "g" "c" "a" "g" "t" "g" "c" "a" "g"
    H. Sapiens "a" "c" "c" "g" "g" "t" "t" "g" "g" "c" "c" "g" "t" "t" "c" "a" "g"
    Chimp "a" "a" "a" "c" "c" "c" "t" "t" "g" "c" "c" "g" "t" "t" "a" "c" "g"
    Gorilla "a" "a" "a" "c" "c" "c" "t" "t" "g" "c" "c" "g" "g" "t" "a" "c" "g"
     18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34
    Turkey "g" "g" "t" "g" "a" "g" "c" "c" "c" "g" "g" "g" "c" "a" "a" "t" "a"
    Salmo gair "g" "g" "t" "g" "a" "g" "c" "c" "g" "t" "g" "g" "c" "c" "g" "g" "g"
    H. Sapiens "g" "g" "t" "a" "c" "a" "g" "g" "t" "t" "g" "g" "c" "c" "g" "t" "t"
    Chimp "c" "t" "t" "a" "a" "a" "c" "c" "g" "a" "g" "g" "c" "c" "g" "g" "g"
    Gorilla "c" "t" "t" "a" "a" "a" "c" "c" "a" "t" "t" "g" "c" "c" "g" "g" "t"
     35 36 37 38 39 40 41 42
    Turkey "c" "a" "g" "g" "g" "t" "a" "t"
    Salmo gair "c" "a" "c" "g" "g" "t" "a" "t"
    H. Sapiens "c" "a" "g" "g" "g" "t" "a" "a"
    Chimp "a" "c" "a" "c" "t" "c" "a" "t"
    Gorilla "a" "c" "g" "c" "t" "t" "a" "a"
    > #
    > # With the majority rule:
    > #
    > res <- consensus(phylip)
    > stopifnot(c2s(res) == "aaaccctggccgttcagggtaaaccgtggccgggcagggtat")
    > #
    > # With a threshold:
    > #
    > res.thr <- consensus(phylip, method = "threshold")
    > res.thr[is.na(res.thr)] <- "." # change NA into dots
    > # stopifnot(c2s(res.thr) == "aa.c..t.gc.gtt..g..t.a.cc..ggccg.......ta.")
    > stopifnot(c2s(res.thr) == "aa.cc.tggccgttcagggtaaacc.tggccgg.cagggtat")
    Error: c2s(res.thr) == "aa.cc.tggccgttcagggtaaacc.tggccgg.cagggtat" is not TRUE
    Execution halted
Flavors: r-devel-linux-x86_64-debian-clang, r-devel-linux-x86_64-debian-gcc, r-devel-linux-x86_64-fedora-clang, r-devel-linux-x86_64-fedora-gcc, r-devel-osx-x86_64-clang

Version: 3.0-7
Check: R code for possible problems
Result: NOTE
    AAstat: no visible binding for global variable ‘SEQINR.UTIL’
    computePI: no visible binding for global variable ‘SEQINR.UTIL’
    recstat: no visible global function definition for ‘dudi.coa’
    summary.SeqFastaAA: no visible binding for global variable
     ‘SEQINR.UTIL’
    tablecode: no visible binding for global variable ‘SEQINR.UTIL’
    translate: no visible binding for global variable ‘SEQINR.UTIL’
    uco: no visible binding for global variable ‘SEQINR.UTIL’
    ucoweight: no visible binding for global variable ‘SEQINR.UTIL’
Flavors: r-devel-linux-x86_64-fedora-gcc, r-devel-windows-ix86+x86_64, r-patched-solaris-sparc, r-patched-solaris-x86

Version: 3.0-7
Check: running examples for arch 'i386'
Result: ERROR
    Running examples in 'seqinr-Ex.R' failed
    The error most likely occurred in:
    
    > ### Name: consensus
    > ### Title: Consensus and profiles for sequence alignments
    > ### Aliases: consensus con
    >
    > ### ** Examples
    >
    > #
    > # Read 5 aligned DNA sequences at 42 sites:
    > #
    > phylip <- read.alignment(file = system.file("sequences/test.phylip",
    + package = "seqinr"), format = "phylip")
    > #
    > # Show data in a matrix form:
    > #
    > (matali <- as.matrix(phylip))
     1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17
    Turkey "a" "a" "g" "c" "t" "n" "g" "g" "g" "c" "a" "t" "t" "t" "c" "a" "g"
    Salmo gair "a" "a" "g" "c" "c" "t" "t" "g" "g" "c" "a" "g" "t" "g" "c" "a" "g"
    H. Sapiens "a" "c" "c" "g" "g" "t" "t" "g" "g" "c" "c" "g" "t" "t" "c" "a" "g"
    Chimp "a" "a" "a" "c" "c" "c" "t" "t" "g" "c" "c" "g" "t" "t" "a" "c" "g"
    Gorilla "a" "a" "a" "c" "c" "c" "t" "t" "g" "c" "c" "g" "g" "t" "a" "c" "g"
     18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34
    Turkey "g" "g" "t" "g" "a" "g" "c" "c" "c" "g" "g" "g" "c" "a" "a" "t" "a"
    Salmo gair "g" "g" "t" "g" "a" "g" "c" "c" "g" "t" "g" "g" "c" "c" "g" "g" "g"
    H. Sapiens "g" "g" "t" "a" "c" "a" "g" "g" "t" "t" "g" "g" "c" "c" "g" "t" "t"
    Chimp "c" "t" "t" "a" "a" "a" "c" "c" "g" "a" "g" "g" "c" "c" "g" "g" "g"
    Gorilla "c" "t" "t" "a" "a" "a" "c" "c" "a" "t" "t" "g" "c" "c" "g" "g" "t"
     35 36 37 38 39 40 41 42
    Turkey "c" "a" "g" "g" "g" "t" "a" "t"
    Salmo gair "c" "a" "c" "g" "g" "t" "a" "t"
    H. Sapiens "c" "a" "g" "g" "g" "t" "a" "a"
    Chimp "a" "c" "a" "c" "t" "c" "a" "t"
    Gorilla "a" "c" "g" "c" "t" "t" "a" "a"
    > #
    > # With the majority rule:
    > #
    > res <- consensus(phylip)
    > stopifnot(c2s(res) == "aaaccctggccgttcagggtaaaccgtggccgggcagggtat")
    > #
    > # With a threshold:
    > #
    > res.thr <- consensus(phylip, method = "threshold")
    > res.thr[is.na(res.thr)] <- "." # change NA into dots
    > # stopifnot(c2s(res.thr) == "aa.c..t.gc.gtt..g..t.a.cc..ggccg.......ta.")
    > stopifnot(c2s(res.thr) == "aa.cc.tggccgttcagggtaaacc.tggccgg.cagggtat")
    Error: c2s(res.thr) == "aa.cc.tggccgttcagggtaaacc.tggccgg.cagggtat" is not TRUE
    Execution halted
Flavor: r-devel-windows-ix86+x86_64

Version: 3.0-7
Check: running examples for arch 'x64'
Result: ERROR
    Running examples in 'seqinr-Ex.R' failed
    The error most likely occurred in:
    
    > ### Name: consensus
    > ### Title: Consensus and profiles for sequence alignments
    > ### Aliases: consensus con
    >
    > ### ** Examples
    >
    > #
    > # Read 5 aligned DNA sequences at 42 sites:
    > #
    > phylip <- read.alignment(file = system.file("sequences/test.phylip",
    + package = "seqinr"), format = "phylip")
    > #
    > # Show data in a matrix form:
    > #
    > (matali <- as.matrix(phylip))
     1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17
    Turkey "a" "a" "g" "c" "t" "n" "g" "g" "g" "c" "a" "t" "t" "t" "c" "a" "g"
    Salmo gair "a" "a" "g" "c" "c" "t" "t" "g" "g" "c" "a" "g" "t" "g" "c" "a" "g"
    H. Sapiens "a" "c" "c" "g" "g" "t" "t" "g" "g" "c" "c" "g" "t" "t" "c" "a" "g"
    Chimp "a" "a" "a" "c" "c" "c" "t" "t" "g" "c" "c" "g" "t" "t" "a" "c" "g"
    Gorilla "a" "a" "a" "c" "c" "c" "t" "t" "g" "c" "c" "g" "g" "t" "a" "c" "g"
     18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34
    Turkey "g" "g" "t" "g" "a" "g" "c" "c" "c" "g" "g" "g" "c" "a" "a" "t" "a"
    Salmo gair "g" "g" "t" "g" "a" "g" "c" "c" "g" "t" "g" "g" "c" "c" "g" "g" "g"
    H. Sapiens "g" "g" "t" "a" "c" "a" "g" "g" "t" "t" "g" "g" "c" "c" "g" "t" "t"
    Chimp "c" "t" "t" "a" "a" "a" "c" "c" "g" "a" "g" "g" "c" "c" "g" "g" "g"
    Gorilla "c" "t" "t" "a" "a" "a" "c" "c" "a" "t" "t" "g" "c" "c" "g" "g" "t"
     35 36 37 38 39 40 41 42
    Turkey "c" "a" "g" "g" "g" "t" "a" "t"
    Salmo gair "c" "a" "c" "g" "g" "t" "a" "t"
    H. Sapiens "c" "a" "g" "g" "g" "t" "a" "a"
    Chimp "a" "c" "a" "c" "t" "c" "a" "t"
    Gorilla "a" "c" "g" "c" "t" "t" "a" "a"
    > #
    > # With the majority rule:
    > #
    > res <- consensus(phylip)
    > stopifnot(c2s(res) == "aaaccctggccgttcagggtaaaccgtggccgggcagggtat")
    > #
    > # With a threshold:
    > #
    > res.thr <- consensus(phylip, method = "threshold")
    > res.thr[is.na(res.thr)] <- "." # change NA into dots
    > # stopifnot(c2s(res.thr) == "aa.c..t.gc.gtt..g..t.a.cc..ggccg.......ta.")
    > stopifnot(c2s(res.thr) == "aa.cc.tggccgttcagggtaaacc.tggccgg.cagggtat")
    Error: c2s(res.thr) == "aa.cc.tggccgttcagggtaaacc.tggccgg.cagggtat" is not TRUE
    Execution halted
Flavor: r-devel-windows-ix86+x86_64

Version: 3.0-7
Check: examples
Result: ERROR
    Running examples in ‘seqinr-Ex.R’ failed
    The error most likely occurred in:
    
    > ### Name: read.abif
    > ### Title: Read ABIF formatted files
    > ### Aliases: read.abif
    >
    > ### ** Examples
    >
    > #
    > # Quality check:
    > #
    >
    > data(JLO)
    > JLO.check <- read.abif(system.file("abif/2_FAC321_0000205983_B02_004.fsa",
    + package = "seqinr"))
    > stopifnot(identical(JLO, JLO.check))
    Error: identical(JLO, JLO.check) is not TRUE
    Execution halted
Flavor: r-patched-solaris-sparc

Version: 3.0-7
Check: R code for possible problems
Result: NOTE
    Found the following assignments to the global environment:
    File ‘seqinr/R/choosebank.R’:
     assign("banknameSocket", res, .GlobalEnv)
    File ‘seqinr/R/extract.breakpoints.R’:
     assign("x.breaks", x.breaks, envir = globalenv())
     assign("y.breaks", y.breaks, envir = globalenv())
    File ‘seqinr/R/modifylist.R’:
     assign(modlistname, result, envir = .GlobalEnv)
    File ‘seqinr/R/query.r’:
     assign(listname, result, envir = .GlobalEnv)
    
    Found the following calls to data() loading into the global environment:
    File ‘seqinr/R/plotabif.R’:
     data(list = allele.names)
    File ‘seqinr/R/plotladder.R’:
     data(list = allele.names)
    See section ‘Good practice’ in ‘?data’.
Flavors: r-release-linux-ix86, r-release-linux-x86_64